eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| hand-foot-genital syndrome | ||||
| Disease ID | 1325 |
|---|---|
| Disease | hand-foot-genital syndrome |
| Definition | Hand-foot-genital syndrome (HFGS) is characterized by limb malformations and urogenital defects. Mild bilateral shortening of the thumbs and great toes, caused primarily by shortening of the distal phalanx and/or the first metacarpal or metatarsal, is the most common limb malformation and results in impaired dexterity or apposition of the thumbs. Urogenital abnormalities include abnormalities of the ureters and urethra and various degrees of incomplete Müllerian fusion in females and hypospadias of variable severity with or without chordee in males. Vesicoureteral reflux, recurrent urinary tract infections, and chronic pyelonephritis are common; fertility is normal.[1] - Wikipedia Reference: https://en.wikipedia.org/wiki/hand-foot-genital syndrome |
| Synonym | hand foot genital syndrome hand foot uterus syndrome hand-foot-genital syndrome (disorder) hand-foot-uterus syndrome hfg hfg syndrome hfu hfu syndrome |
| Orphanet | |
| OMIM | |
| UMLS | C1841679 |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:11) 655 | BMP7 | 1.736 | DISEASES 1687 | DFNA5 | 4.345 | DISEASES 1750 | DLX6 | 3.501 | DISEASES 2128 | EVX1 | 3.92 | DISEASES 2159 | F10 | 1.876 | DISEASES 23017 | FAIM2 | 2.943 | DISEASES 9734 | HDAC9 | 2.424 | DISEASES 3200 | HOXA3 | 4.644 | DISEASES 3239 | HOXD13 | 5.6 | DISEASES 3897 | L1CAM | 2.633 | DISEASES 9378 | NRXN1 | 2.684 | DISEASES |
| Locus | Symbol | Locus(Total Locus:1) HOXA13 | 7p15.2 |
| Disease ID | 1325 |
|---|---|
| Disease | hand-foot-genital syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:25) HP:0001629 | Ventricular septal defect HP:0007477 | Abnormal dermatoglyphics HP:0000010 | Recurrent urinary tract infections HP:0000074 | Ureteropelvic junction obstruction HP:0000047 | Hypospadias HP:0000130 | Abnormality of the uterus HP:0010105 | Short first metatarsal HP:0010109 | Short hallux HP:0000486 | Strabismus HP:0000960 | Sacral dimple HP:0001162 | Postaxial hand polydactyly HP:0000076 | Vesicoureteral reflux HP:0008080 | Hallux varus HP:0009778 | Short thumb HP:0005268 | Spontaneous abortion HP:0000795 | Abnormality of the urethra HP:0000813 | Bicornuate uterus HP:0009623 | Proximal placement of thumb HP:0004209 | Clinodactyly of the 5th finger HP:0006110 | Shortening of all middle phalanges of the fingers HP:0010034 | Short 1st metacarpal HP:0005048 | Synostosis of carpal bones HP:0011937 | Hypoplastic fifth toenail HP:0008551 | Microtia HP:0009882 | Short distal phalanx of finger |
| Text Mined Phenotype | (Waiting for update.) |
| Disease ID | 1325 |
|---|---|
| Disease | hand-foot-genital syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:3) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104894019 | NA | 3209 | HOXA13 | umls:C1841679 | CLINVAR | NA | 0.563257302 | NA | HOXA13 | 7 | 27198258 | C | T |
| rs121912542 | NA | 3209 | HOXA13 | umls:C1841679 | CLINVAR | NA | 0.563257302 | NA | HOXA13 | 7 | 27198251 | T | G |
| rs387906542 | NA | 3209 | HOXA13 | umls:C1841679 | CLINVAR | NA | 0.563257302 | NA | HOXA13;HOTTIP | 7 | 27199671 | - | AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:16) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0010034 | Short 1st metacarpal | MP:0004634 | short metacarpal bones | reduced length of the five bones of the forepaws that articulate proximally with the carpal bones and distally with the phalanges |
| HP:0001162 | Postaxial hand polydactyly | MP:0009743 | preaxial polydactyly | duplication of all or part of the first ray on one or more of the autopods |
| HP:0000795 | Abnormality of the urethra | MP:0002053 | decreased incidence of induced tumors | reduced frequency of tumor incidence induced by a carcinogen, mutagen or virus |
| HP:0000076 | Vesicoureteral reflux | MP:0001948 | vesicoureteral reflux | the retrograde flow of urine from the bladder into the ureters and kidneys |
| HP:0010105 | Short first metatarsal | MP:0003072 | abnormal metatarsal bone morphology | any structural anomaly in the five bones of the hindpaws/feet that articulate proximally with the cuneiform and cuboid bones of the tarsus and distally with the phalanges |
| HP:0000813 | Bicornuate uterus | MP:0003558 | absent uterus | absence of the female muscular organ of gestation |
| HP:0009623 | Proximal placement of thumb | MP:0009886 | failure of palatal shelf elevation | the palatal shelves fail to move from a vertical position in the orofacial cavity to a horizontal apposition above the developing tongue |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0006110 | Shortening of all middle phalanges of the fingers | MP:0010728 | fusion of atlas and occipital bones | union of elements of the atlas and the bone at the lower, posterior part of the skull into one structure |
| HP:0001629 | Ventricular septal defect | MP:0011667 | double outlet right ventricle with atrioventricular septal defect | a form of DORV in which there is also a complete atrioventricular canal |
| HP:0000074 | Ureteropelvic junction obstruction | MP:0003270 | intestinal obstruction | any impediment, blockage, or reversal of the normal flow of the intestinal contents toward the anus |
| HP:0000130 | Abnormality of the uterus | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0000010 | Recurrent urinary tract infections | MP:0014044 | absent cardiac outflow tract | absence of or complete failure to form the common arterial trunk that normally forms the aorta and pulmonary artery and the ventricular outflow regions |
| HP:0005048 | Synostosis of carpal bones | MP:0012528 | abnormal zone of polarizing activity morphology | any structural anomaly of the subset of cells found in the posterior mesenchyme region of the vertebrate limb bud; Sonic hedgehog (Shh) produced by ZPA represents the key mediator of the polarizing activity that regulates patterning of the limb along the |
| HP:0010109 | Short hallux | MP:0009001 | absent hallux | absence of the first or primary digit of the foot |
| HP:0009882 | Short distal phalanx of finger | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
Mapped by homologous gene(Total Items:25) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008551 | Microtia | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0008080 | Hallux varus | MP:0014152 | absent exorbital lacrimal gland | absence of the large extra-orbital lacrimal gland that, in mice, is normally located subcutaneously at the anteroventral base of the ear adjacent to the parotid gland |
| HP:0001162 | Postaxial hand polydactyly | MP:0014117 | increased pancreatic beta cell apoptosis | increase in the number of pancreatic beta cells undergoing programmed cell death |
| HP:0001629 | Ventricular septal defect | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0006110 | Shortening of all middle phalanges of the fingers | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0007477 | Abnormal dermatoglyphics | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0000047 | Hypospadias | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0009882 | Short distal phalanx of finger | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000076 | Vesicoureteral reflux | MP:0014155 | absent olfactory epithelium | absence of the epithelial cells that line the interior of the nose |
| HP:0000813 | Bicornuate uterus | MP:0013545 | cleft hard palate | cleft in the anterior portion of the palate consisting of bone and mucous membranes; the hard palate is formed from bony processes of the maxilla, premaxilla and palatine bones |
| HP:0010105 | Short first metatarsal | MP:0013323 | abnormal ampullary gland morphology | any structural anomaly of the paired accessory, glandular, androgen-dependent outpouchings of the proximal ductus deferens, one on each side, that produce and secrete lipids and glycogen, components of the seminal fluid; they open into the ampullae at the |
| HP:0000960 | Sacral dimple | MP:0013787 | photophobia | abnormal aversion or avoidance behavior in response to light; photophobia is symptom of abnormal intolerance to visual perception of light; as a medical symptom, photophobia is not a morbid fear or phobia, but an experience of discomfort or pain to the e |
| HP:0000795 | Abnormality of the urethra | MP:0011966 | abnormal auditory brainstem response waveform shape | any anomaly in the characteristic pattern of electrical activity recording of a series of vertex positive waves generated by neurons in the ascending auditory system, that can be recorded from scalp electrograms by using computer-averaged responses to sho |
| HP:0000074 | Ureteropelvic junction obstruction | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0010034 | Short 1st metacarpal | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000130 | Abnormality of the uterus | MP:0013508 | increased granulosa cell apoptosis | increase in the timing or the number of granulsa cells undergoing programmed cell death |
| HP:0009623 | Proximal placement of thumb | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0005048 | Synostosis of carpal bones | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000010 | Recurrent urinary tract infections | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0011937 | Hypoplastic fifth toenail | MP:0012119 | increased trophectoderm apoptosis | increase in the number of trophectoderm cells undergoing programmed cell death |
| HP:0009778 | Short thumb | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0010109 | Short hallux | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0005268 | Spontaneous abortion | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| Disease ID | 1325 |
|---|---|
| Disease | hand-foot-genital syndrome |
| Case | (Waiting for update.) |